Information In Noncoding For ENCR40010097

Accession Number:  ENCR40010097	Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0059	Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus	RefSeq:   NC_011916
Condition:   Rich medium	locus_tag:   -
Date:   2018/11/11	Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:624.

Nucleotide sequence:   UCCAGGGGAGAGAAAAUCACGGUCAAAAUUCAAACACGCGUUCGAGACCUAAGCCAAGGCAGAAAAACUGCAACGGCUACGGUUCCGAGAGCGAAGGC

Molecular structure In Noncoding For ENCR40010097

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -27.2 kcal/mol is given below.

(((...)))...........................(((.((((.((((..((((...((((.....))))...))))..)))).)))).)))..... (-27.20) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -28.21 kcal/mol.

The frequency of the MFE structure in the ensemble is 19.39 %.

The ensemble diversity is 5.34

{((...}}}.......,,..................(((.((((.((((..((((...((((.....))))...))))..)))).)))).)))..... [-28.21]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -27.20 kcal/mol is given below.

(((...)))...........................(((.((((.((((..((((...((((.....))))...))))..)))).)))).)))..... {-27.20 d=3.44} [ VIEW IN FORNA ]