Information In Noncoding For ENCR40010098

Accession Number:  ENCR40010098 Category:   tRNA
Cross-Ref:   Nondisruptable_sequence_ID: CCNA_99960; Rfam: RF00005 Description:   tRNA (GUG) (CCNA_R0056)
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:625.
Nucleotide sequence:   GGCGGAUGCGUAGCUCAGCGGGAGAGCACCUCGUUCACACCGAGGGGGUCACAGGUUCAAUCCCUGUCGCAUCCACCAUUCUCCUCUUCUUUUGUGC


Molecular structure In Noncoding For ENCR40010098

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -31.6 kcal/mol is given below.
((.(((((((..((((.......)))).(((((.......))))).....(((((.......)))))))))))).)).................... (-31.60) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -32.52 kcal/mol.
The frequency of the MFE structure in the ensemble is 22.4 %.
The ensemble diversity is 11.24
((.(((((((..((((.......)))){((((,{{.....,))})}}}}.(((((.......)))))))))))).)).................... [-32.52]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -29.70 kcal/mol is given below.
((.(((((((..((((.......))))(((((............))))).(((((.......)))))))))))).)).................... {-29.70 d=7.75} [ VIEW IN FORNA ]