Information In Noncoding For ENCR40010099

Accession Number:  ENCR40010099	Category:   tRNA
Cross-Ref:   Nondisruptable_sequence_ID: CCNA_99984; Rfam: RF00005	Description:   tRNA (UCC) (CCNA_R0024)
Organism:   Caulobacter crescentus	RefSeq:   NC_011916
Condition:   Rich medium	locus_tag:   -
Date:   2018/11/11	Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:626.

Nucleotide sequence:   UGGUGAGGUGGCCGAGUGGUUGAAGGCGCACGCCUGGAACGCGUGUAUAGGGGAAACUCUAUCGAGGGUUCGAAUCCCUCUCUCACCGCCACUACUC

Molecular structure In Noncoding For ENCR40010099

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -35.7 kcal/mol is given below.

.(((((((..(((...........)))((((((.......))))))((((((....)))))).(((((.......)))))))))))).......... (-35.70) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -37.07 kcal/mol.

The frequency of the MFE structure in the ensemble is 10.76 %.

The ensemble diversity is 16.36

,(((({((,,(((...........)))((((((.......))))))((((((....)))))).(((((.......))))),}})))),.,,,,.... [-37.07]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -35.40 kcal/mol is given below.

.((((((...(((...........)))((((((.......))))))((((((....)))))).(((((.......))))).)))))).......... {-35.40 d=10.63} [ VIEW IN FORNA ]