Information In Noncoding For ENCR40010102

Accession Number:  ENCR40010102 Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0073 Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:629.
Nucleotide sequence:   GCUAACAUAGCAUUAACGUCAACAAUAACGCACCUGCACUCAAGUACGACCAUACCGCGAAACGAUGAAUUUCGAUGCAUACAAUACCGCCUAAAGC


Molecular structure In Noncoding For ENCR40010102

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -8.00 kcal / mol is given below.
((((...))))......(((.((......((....))......))..)))......(((...(((......))).)))................... (-8.00) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -9.69 kcal/mol.
The frequency of the MFE structure in the ensemble is 6.44 %.
The ensemble diversity is 17.67
((({...}))).....,((,........,{{....}}......}}..},.......(((...(((......))).)))................... [-9.69]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -6.50 kcal/mol is given below.
((((...)))).............................................(((...(((......))).)))................... { -6.50 d=11.29} [ VIEW IN FORNA ]