Information In Noncoding For ENCR40010103

Accession Number:  ENCR40010103 Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0082 Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:630.
Nucleotide sequence:   AUUGGGACCUAACGCCGCGCUAACACCCCAAUCCGAGGACGUCAAUUUCGCGAAAACUUCACAACACCGUCACAGUGCUUGCGGAGCUGUUUACAAG


Molecular structure In Noncoding For ENCR40010103

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -14.7 kcal/mol is given below.
((((((.......((...))......))))))..........((.((((((((..(((..((......))...)))..)))))))).))........ (-14.70) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -16.93 kcal/mol.
The frequency of the MFE structure in the ensemble is 2.67 %.
The ensemble diversity is 18.37
{(((((.......({...},......)))))}....,{,,{.,,.{(((((((..(((..((......))...)))..)))))))).}),,...... [-16.93]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -13.60 kcal/mol is given below.
((((((....................)))))).............((((((((..(((..((......))...)))..))))))))........... {-13.60 d=11.56} [ VIEW IN FORNA ]