Information In Noncoding For ENCR40010104

Accession Number:  ENCR40010104	Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0071	Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus	RefSeq:   NC_011916
Condition:   Rich medium	locus_tag:   -
Date:   2018/11/11	Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:631.

Nucleotide sequence:   CCCCGAACAGACAAAAAUCCCUUGCAAGUUUUACUAAUCACACUCAAUCUAGCGAAAGUUGUUUUGCUUCUACUAAUGGCACCCCCUCGUCUGGAG

Molecular structure In Noncoding For ENCR40010104

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -12.8 kcal/mol is given below.

.......(((((...........((((.((((.(((.............))).)))).))))..((((.........)))).......)))))... (-12.80) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -13.5 kcal/mol.

The frequency of the MFE structure in the ensemble is 32.26 %.

The ensemble diversity is 8.79

.......(((((...........((((.((((.(((.............))).)))).))))..{(((.........)))).......)))))... [-13.50]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -12.80 kcal/mol is given below.

.......(((((...........((((.((((.(((.............))).)))).))))..((((.........)))).......)))))... {-12.80 d=5.07} [ VIEW IN FORNA ]