Information In Noncoding For ENCR40010105

Accession Number:  ENCR40010105	Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0006	Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus	RefSeq:   NC_011916
Condition:   Rich medium	locus_tag:   -
Date:   2018/11/11	Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:632.

Nucleotide sequence:   UGUUUAACUGUCCUAAAUUCGAUAUUUACCAAAACAGAACUCCAAUUUACUUGGUAAAUUGCGCGAAAAAGAUUGUGAUGAAUUGUAGGUUAAUG

Molecular structure In Noncoding For ENCR40010105

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -13.6 kcal/mol is given below.

...........(((((((((...(((((((((..................)))))))))..(((((......)))))..))))).))))...... (-13.60) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -15.53 kcal/mol.

The frequency of the MFE structure in the ensemble is 4.35 %.

The ensemble diversity is 12.21

....,,,.,..((({(((((,..(((((((((..............,...)))))))))..(((((......))))).,))))).}))),,}... [-15.53]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -13.60 kcal/mol is given below.

...........(((((((((...(((((((((..................)))))))))..(((((......)))))..))))).))))...... {-13.60 d=7.64} [ VIEW IN FORNA ]