Information In Noncoding For ENCR40010106

Accession Number:  ENCR40010106 Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0016 Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:633.
Nucleotide sequence:   CGCGGCUGUCACGUCGUCGAAGACAAUAGCAUAAAAUUAAGCCCUAUGAAAGGGUUGCGUCCUGGCGCGCAAAGAGACGCCGCCAAGCUUUCGCG


Molecular structure In Noncoding For ENCR40010106

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -29.6 kcal/mol is given below.
(((((((((...(((......))).))))).........((((((.....))))))......(((((.((........)))))))......)))) (-29.60) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -30.87 kcal/mol.
The frequency of the MFE structure in the ensemble is 12.72 %.
The ensemble diversity is 10.21
(((((((((...(((......))).))))).........((((((.....)))))),,,...(((((.((........))))))).},...)))) [-30.87]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -29.60 kcal/mol is given below.
(((((((((...(((......))).))))).........((((((.....))))))......(((((.((........)))))))......)))) {-29.60 d=5.97} [ VIEW IN FORNA ]