Information In Noncoding For ENCR40010107

Accession Number:  ENCR40010107 Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0038 Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:634.
Nucleotide sequence:   CGCCGACACGAAAACGCGAGAAAAUCCACACGUAUGGUUGACAACGUUGUCACGUUUCCGGUGAAUGCGACAUCCGCGCGAAGACGGAUUUGACA


Molecular structure In Noncoding For ENCR40010107

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -18 kcal/mol is given below.
(((..((.((.(((((.((.((........(((.((.....))))))).)).))))).))))....)))..(((((........)))))...... (-18.00) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -21.51 kcal/mol.
The frequency of the MFE structure in the ensemble is 0.34 %.
The ensemble diversity is 24.04
(((((...,(,{((((.((.{....,,,.{{{{.{|,....}}}}})).)).)))))})))))...|(({.(((((........)))))})).,. [-21.51]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -11.20 kcal/mol is given below.
(((((....(..((((.((.(.........(((..(.....).))).).)).)))).))))))....(((.(((((........))))))))... {-11.20 d=16.78} [ VIEW IN FORNA ]