Information In Noncoding For ENCR40010108

Accession Number:  ENCR40010108	Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0051	Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus	RefSeq:   NC_011916
Condition:   Rich medium	locus_tag:   -
Date:   2018/11/11	Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:635.

Nucleotide sequence:   CUUUUGAUUCUUCGCGACUUUCGGCCCAACCAACAGCUAACUCUCUGAUUUUUCGAACCUUUCGCCCGUUAACAAAGCUCGGCUUGACUUUGCAG

Molecular structure In Noncoding For ENCR40010108

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -9.20 kcal / mol is given below.

.............((((..((.((((........((((.......((((....((((...))))...))))....)))).)))).))..)))).. (-9.20) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -11.49 kcal/mol.

The frequency of the MFE structure in the ensemble is 2.43 %.

The ensemble diversity is 26.64

.....,,......((((..{(,(({{.......,((,,......,||,....,||||....))),..||,..,,,||}|,}}}}.)),,)))}.. [-11.49]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -3.67 kcal/mol is given below.

.............((((......(((......................................................)))......)))).. { -3.67 d=18.77} [ VIEW IN FORNA ]