Information In Noncoding For ENCR40010109

Accession Number:  ENCR40010109 Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0067 Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:636.
Nucleotide sequence:   UCGUGAUGCGUGUCGGGCCGGCUGUCUCGCUUUGGCACGGAAAGGCCAGUGAAAUAAGGGUUUCAGCGCGGUCGCCUCGUCGCCCGGCUCAAAGC


Molecular structure In Noncoding For ENCR40010109

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -28.9 kcal/mol is given below.
...(((.(((((.((((.((((((...(((((((((........))))).(((((....))))))))))))))).)))).)))...))))).... (-28.90) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -31.6 kcal/mol.
The frequency of the MFE structure in the ensemble is 1.26 %.
The ensemble diversity is 27.69
..,{...{{,.((((((({((({(,,.{((,,((((........))))}{(((((....)))))))))}))})),}.,}.,))))))).},..,, [-31.60]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -19.30 kcal/mol is given below.
...........(((((((.........(((..((((........))))..(((((....))))).))).............)))))))....... {-19.30 d=18.60} [ VIEW IN FORNA ]