Information In Noncoding For ENCR40010111

Accession Number:  ENCR40010111	Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0002	Description:   upstream of CCNA_00045
Organism:   Caulobacter crescentus	RefSeq:   NC_011916
Condition:   Rich medium	locus_tag:   -
Date:   2018/11/11	Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:638.

Nucleotide sequence:   UUCUGGGCCGGCGGCGCUGAGACCGUUCGGCCAAACAAAAAGCGGCAGCCUUUCGGGCCGCCGCUCGAAAGCGCCAUCUAGCGCUAACGGACGA

Molecular structure In Noncoding For ENCR40010111

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -41.9 kcal/mol is given below.

.(((((((((((((........))).))))))........((((((.((((...)))).))))))....(((((......)))))..))))... (-41.90) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -42.95 kcal/mol.

The frequency of the MFE structure in the ensemble is 18.15 %.

The ensemble diversity is 4.97

.{((((((((((((........)))}})))))........((((((.((((...)))).))))))....(((((......)))))..)))}... [-42.95]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -41.90 kcal/mol is given below.

.(((((((((((((........)))).)))))........((((((.((((...)))).))))))....(((((......)))))..))))... {-41.90 d=3.69} [ VIEW IN FORNA ]