Information In Noncoding For ENCR40010114

Accession Number:  ENCR40010114	Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0040	Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus	RefSeq:   NC_011916
Condition:   Rich medium	locus_tag:   -
Date:   2018/11/11	Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:641.

Nucleotide sequence:   UUCCAUUCCGAUCUAAUAUGGAACAAAAAUUCCUUCUAGAUGGAAAGCGGAACGGCUCGUCGAGUUUCCGGCGUUUGUGUUGGGGUGCGGAAC

Molecular structure In Noncoding For ENCR40010114

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -23.3 kcal/mol is given below.

.....(((((.(((((((((((.......((((........))))(((......)))(((((......))))))))))))))))...))))). (-23.30) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -26.1 kcal/mol.

The frequency of the MFE structure in the ensemble is 1.06 %.

The ensemble diversity is 37.47

,,{{.((((({((((,,,,((({......||||...,,,,,)))).{({{{,..{{{(...}}}}}}}))||}}}},}))))))}},))))}. [-26.10]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -7.00 kcal/mol is given below.

...................(((........)))...............(((...((((...)))).)))........................ { -7.00 d=27.10} [ VIEW IN FORNA ]