Information In Noncoding For ENCR40010115

Accession Number:  ENCR40010115	Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0045	Description:   upstream of CCNA_01547
Organism:   Caulobacter crescentus	RefSeq:   NC_011916
Condition:   Rich medium	locus_tag:   -
Date:   2018/11/11	Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:642.

Nucleotide sequence:   CUUUCGUCAGGCUGAUCCCGAGAACGCUGUUCGGUCAAUCGGCUUGCGCUUUCGUUUCGGGCGCGAGCCUUCUAUAUGCGGACCCUUCCAAGC

Molecular structure In Noncoding For ENCR40010115

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -27.1 kcal/mol is given below.

.........((((((...((....))....))))))....(((((((((((.......)))))))))))..........(((....))).... (-27.10) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -29 kcal/mol.

The frequency of the MFE structure in the ensemble is 4.61 %.

The ensemble diversity is 20.77

.....,,..((((((..,((,,..,,...,))))))....(((((((((({.......)))))))))))........,,|||....,}}.... [-29.00]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -19.70 kcal/mol is given below.

........................................(((((((((((.......)))))))))))..........((......)).... {-19.70 d=14.16} [ VIEW IN FORNA ]