Information In Noncoding For ENCR40010119

Accession Number:  ENCR40010119	Category:   tRNA
Cross-Ref:   Nondisruptable_sequence_ID: CCNA_99980; Rfam: RF00005	Description:   tRNA (ACA) (CCNA_R0029)
Organism:   Caulobacter crescentus	RefSeq:   NC_011916
Condition:   Rich medium	locus_tag:   -
Date:   2018/11/11	Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:646.

Nucleotide sequence:   CCCUGGACAAGGGAAAUGGUGCCGGCUGAGGGGAUCGAACCCCCGACCUUCGGUUUACAAAACCGCUGCACUACCGCUGUGCUAAGCCGGCU

Molecular structure In Noncoding For ENCR40010119

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -35.7 kcal/mol is given below.

((((.....)))).......(((((((..((((.......))))......((((((...))))))..((((.......))))..))))))). (-35.70) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -36.85 kcal/mol.

The frequency of the MFE structure in the ensemble is 15.4 %.

The ensemble diversity is 8.27

((((.....)))).......(((((((,.((((......,))))......((((({...})))))..((((.......))))..))))))). [-36.85]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -28.00 kcal/mol is given below.

((((.....)))).......(((((((.......................((((((...))))))..((((.......))))..))))))). {-28.00 d=5.89} [ VIEW IN FORNA ]