Information In Noncoding For ENCR40010127

Accession Number:  ENCR40010127 Category:   non-coding element
Cross-Ref:   Nondisruptable_sequence_ID: Gap_0087 Description:   nondisruptable intergenic region
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:654.
Nucleotide sequence:   AGGGGGACCGGCGGCGCCAGCCGCGCCGCCGGCUUUCGGAAGAAGAAAGGGCGAUCCGCUUGGCGGGUCGCCCUUUUUCCUUGUCCGGAGG


Molecular structure In Noncoding For ENCR40010127

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -61.9 kcal/mol is given below.
.......((((((((((.....))))))))))((((((((((.((((((((((((((((...)))))))))))))))).))..)))))))) (-61.90) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -62.57 kcal/mol.
The frequency of the MFE structure in the ensemble is 33.55 %.
The ensemble diversity is 4.68
.......((((((((((.....))))))))))((((((((((.((((((((((((((((...)))))))))))))))).))..)))))))) [-62.57]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -61.90 kcal/mol is given below.
.......((((((((((.....))))))))))((((((((((.((((((((((((((((...)))))))))))))))).))..)))))))) {-61.90 d=2.77} [ VIEW IN FORNA ]