Information In Noncoding For ENCR40010128

Accession Number:  ENCR40010128 Category:   tRNA
Cross-Ref:   Nondisruptable_sequence_ID: CCNA_99991; Rfam: RF00005 Description:   tRNA (UCG) (CCNA_R0007)
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:655.
Nucleotide sequence:   GCGGAGAGGGUGGGAUUCGAACCCACGUUACGCUUUCACGUAAACCGCAUUUCGAGUGCGGCGCAUUCGACCACUCUGCCACCUCUCCAG


Molecular structure In Noncoding For ENCR40010128

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -33.2 kcal/mol is given below.
..((((((((((((.......))))).(((((......)))))...(((..((((((((...))))))))......)))..))))))).. (-33.20) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -34.54 kcal/mol.
The frequency of the MFE structure in the ensemble is 11.3 %.
The ensemble diversity is 12.65
..((((((((((((.......))))).(((((......))))).{,(((,.,{{{||||,,.|||}}}}}......}))..))))))).. [-34.54]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -31.80 kcal/mol is given below.
..((((((((((((.......))))).(((((......))))).........(((((((...)))))))............))))))).. {-31.80 d=10.40} [ VIEW IN FORNA ]