Information In Noncoding For ENCR40010133

Accession Number:  ENCR40010133 Category:   promoter; regulatory region
Cross-Ref:   Regulatory_region_ID: RR_00005 Description:   TSS position: -; CCNA leading gene: CCNA_00005 ; CCNA lagging gene: CCNA_00005 ; annotation of leading gene: DNA polymerase III
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:  
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:660.
Nucleotide sequence:   CUUGAAGCCGACCGCGAACGGCUUCAUGGAAGGGCCA


Molecular structure In Noncoding For ENCR40010133

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -13.3 kcal/mol is given below.
..((((((((........))))))))(((.....))) (-13.30) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -13.87 kcal/mol.
The frequency of the MFE structure in the ensemble is 39.57 %.
The ensemble diversity is 1.97
..((((((((........)))))))),((.....)), [-13.87]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -12.90 kcal/mol is given below.
..((((((((........)))))))).((.....)). {-12.90 d=1.40} [ VIEW IN FORNA ]