Information In Noncoding For ENCR40010136

Accession Number:  ENCR40010136 Category:   promoter; regulatory region
Cross-Ref:   Regulatory_region_ID: RR_00010 Description:   TSS position: 146b ; CCNA leading gene: CCNA_00010 ; CCNA lagging gene: CCNA_00010 ; annotation of leading gene: chaperone protein DnaK
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:663.
Nucleotide sequence:   CCUAAAGGAGCGACAGGUACGAAGA


Molecular structure In Noncoding For ENCR40010136

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of 0.00 kcal / mol is given below.
......................... 0 [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -0.84 kcal/mol.
The frequency of the MFE structure in the ensemble is 25.62 %.
The ensemble diversity is 2.92
{{....,,..,.....,........ [-0.84]


The centroid secondary structure in dot-bracket notation with a minimum free energy of 0.00 kcal/mol is given below.
......................... { 0.00 d=1.95} [ VIEW IN FORNA ]