Information In Noncoding For ENCR40010137

Accession Number:  ENCR40010137 Category:   promoter; regulatory region
Cross-Ref:   Regulatory_region_ID: RR_00033 Description:   TSS position: -; CCNA leading gene: CCNA_00033 ; CCNA lagging gene: CCNA_00033 ; annotation of leading gene: polyribonucleotide nucleotidyltransferase/polynucleotide adenylyltransferase
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:664.
Nucleotide sequence:   GUCCGAGGGUUCACGUCCUCAAACCCGCCUGUCACACUGGAUGAGGAUCAUCGGGCCGGCUUCCGUUAGCCGUCCGCCCCUGUCCGCCCCGACGGGAAUCCGCCCGCGGGAACCGAAAGAAGAAAA


Molecular structure In Noncoding For ENCR40010137

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -42.7 kcal/mol is given below.
((((((.(((((.(((((....................))))).))))).))))))(((((......)))))...((........))((((.((((......))))))))................ (-42.70) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -44.68 kcal/mol.
The frequency of the MFE structure in the ensemble is 4.02 %.
The ensemble diversity is 33.37
,{({({,((({{.,(((({{,...,,............))}))})))),.,|||||(((((......))))),,,}..|{{,,,.,.{(((.((((......))))))))...,,........... [-44.68]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -22.70 kcal/mol is given below.
........................................................(((((......)))))...............((((.((((......))))))))................ {-22.70 d=23.96} [ VIEW IN FORNA ]