Information In Noncoding For ENCR40010142

Accession Number:  ENCR40010142	Category:   promoter; regulatory region
Cross-Ref:   Regulatory_region_ID: RR_00048	Description:   TSS position: 39a ; CCNA leading gene: CCNA_00048 ; CCNA lagging gene: CCNA_00048 ; annotation of leading gene: S-adenosylmethionine synthetase
Organism:   Caulobacter crescentus	RefSeq:   NC_011916
Condition:   Rich medium	locus_tag:   -
Date:   2018/11/11	Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:669.

Nucleotide sequence:   AAGCUCACCUUGCUCGCAUAAACAUAUCUUUAUAUGAUUCUGGUCUAACUGAACGCCGACUGGGCGCCGCGCGCCCGUGCGUGUCUUCAUGACCGGAGCUGUCU

Molecular structure In Noncoding For ENCR40010142

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -31.5 kcal/mol is given below.

.(((.......)))........(((((....))))).((((((((.....((((((..((.((((((...)))))))))))).)).....))))))))...... (-31.50) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -34.11 kcal/mol.

The frequency of the MFE structure in the ensemble is 1.44 %.

The ensemble diversity is 20.43

.(((.......))}.,......{{{{,....))})).,(((((((.....((((((..{{.((((((...)))))))),}))})}.....)))))))),..... [-34.11]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -23.20 kcal/mol is given below.

.(((.......)))........((((......))))..(((((((.....(.......((.((((((...))))))))......).....)))))))....... {-23.20 d=14.68} [ VIEW IN FORNA ]