Information In Noncoding For ENCR40010149

Accession Number:  ENCR40010149 Category:   promoter; regulatory region
Cross-Ref:   Regulatory_region_ID: RR_00070 Description:   TSS position: -; CCNA leading gene: CCNA_00070 ; CCNA lagging gene: CCNA_00071 ; annotation of leading gene: porphobilinogen deaminase
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:676.
Nucleotide sequence:   GUUGCGGGCUUUCCGCCGCUCCUGUAGCAGCGAAGACGAAUUUUCGUCUCCGCAGGUAACGUUCAGACCG


Molecular structure In Noncoding For ENCR40010149

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -22.5 kcal/mol is given below.
(((((((((........)).)).))))).(((.((((((....)))))).))).(((.........))). (-22.50) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -23.87 kcal/mol.
The frequency of the MFE structure in the ensemble is 10.84 %.
The ensemble diversity is 15.31
(({((((({.....,,.)}.,,,}}})).(((.((((((....)))))).))).{||.........,}}. [-23.87]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -14.40 kcal/mol is given below.
(((((..................))))).(((.((((((....)))))).))).((...........)). {-14.40 d=10.69} [ VIEW IN FORNA ]