Information In Noncoding For ENCR40010151

Accession Number:  ENCR40010151 Category:   promoter; regulatory region
Cross-Ref:   Regulatory_region_ID: RR_99993 Description:   TSS position: -; CCNA leading gene: CCNA_99993 ; CCNA lagging gene: CCNA_99993 ; annotation of leading gene: tRNA-Thr
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:678.
Nucleotide sequence:   UGCAAGACGGCGCUUGCCGAGCGGCUCGCGCGCCGCUAAAUAGGCGCUCCCUUCGCUCUGGAGCGCCCGCUUCGGAGCCCGUGGG


Molecular structure In Noncoding For ENCR40010151

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -43.3 kcal/mol is given below.
........((((((((...((((((......))))))...))))))))(((...((((((((((....))))))))))....))) (-43.30) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -43.64 kcal/mol.
The frequency of the MFE structure in the ensemble is 57.69 %.
The ensemble diversity is 2.42
........((((((((...((((((......))))))...))))))))(((...((((((((((....))))))))))....))) [-43.64]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -43.30 kcal/mol is given below.
........((((((((...((((((......))))))...))))))))(((...((((((((((....))))))))))....))) {-43.30 d=1.33} [ VIEW IN FORNA ]