Information In Noncoding For ENCR40010152

Accession Number:  ENCR40010152 Category:   promoter; regulatory region
Cross-Ref:   Regulatory_region_ID: RR_00082 Description:   TSS position: 19a ; CCNA leading gene: CCNA_00082 ; CCNA lagging gene: CCNA_00082 ; annotation of leading gene: class 1 lysyl-tRNA synthetase
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:679.
Nucleotide sequence:   CCCUAGCCCUCCGCCCUCGCGCGGUUUAUACGCCCCGC


Molecular structure In Noncoding For ENCR40010152

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -6.10 kcal / mol is given below.
..................(((.(((......))).))) (-6.10) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -6.88 kcal/mol.
The frequency of the MFE structure in the ensemble is 28.3 %.
The ensemble diversity is 8.05
.....,,....,||....{{|.||{......}}}.}}} [-6.88]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -6.10 kcal/mol is given below.
..................(((.(((......))).))) { -6.10 d=5.80} [ VIEW IN FORNA ]