Information In Noncoding For ENCR40010154

Accession Number:  ENCR40010154 Category:   promoter; regulatory region
Cross-Ref:   Regulatory_region_ID: RR_00106 Description:   TSS position: -; CCNA leading gene: CCNA_00106 ; CCNA lagging gene: CCNA_00106 ; annotation of leading gene: 2-polyprenyl-6-methoxyphenol hydroxylase
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:681.
Nucleotide sequence:   CUCUGGACAGCGACCGGCGGCGAGGCCCAUAUCGCCGCCA


Molecular structure In Noncoding For ENCR40010154

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -17.8 kcal/mol is given below.
...............((((((((........)))))))). (-17.80) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -18.27 kcal/mol.
The frequency of the MFE structure in the ensemble is 46.48 %.
The ensemble diversity is 1.44
....,,.......,,((((((((........)))))))). [-18.27]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -17.80 kcal/mol is given below.
...............((((((((........)))))))). {-17.80 d=1.06} [ VIEW IN FORNA ]