Information In Noncoding For ENCR40010156

Accession Number:  ENCR40010156 Category:   promoter; regulatory region
Cross-Ref:   Regulatory_region_ID: RR_00116 Description:   TSS position: 129a
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:  
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:683.
Nucleotide sequence:   CCCUAAAGAGACGACAGCACGACC


Molecular structure In Noncoding For ENCR40010156

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of 0.00 kcal / mol is given below.
........................ 0 [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -0.22 kcal/mol.
The frequency of the MFE structure in the ensemble is 70.31 %.
The ensemble diversity is 1.00
........................ [-0.22]


The centroid secondary structure in dot-bracket notation with a minimum free energy of 0.00 kcal/mol is given below.
........................ { 0.00 d=0.61} [ VIEW IN FORNA ]