Information In Noncoding For ENCR40010157

Accession Number:  ENCR40010157	Category:   promoter; regulatory region
Cross-Ref:   Regulatory_region_ID: RR_00117	Description:   "TSS position: 71b ; CCNA leading gene: CCNA_00117 ; CCNA lagging gene: CCNA_00117 ; annotation of leading gene: glucosamine-fructose-6-phosphate aminotransferase, isomerizing"
Organism:   Caulobacter crescentus	RefSeq:   NC_011916
Condition:   Rich medium	locus_tag:
Date:   2018/11/11	Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:684.

Nucleotide sequence:   GCCAGUGCUAAAGGCGCCUCACGGAAAUUCGCGUGUCGGUAGGCAUAAUCCUGUCGGCGCGUUCUACAAGGGAUCAUGGCCCA

Molecular structure In Noncoding For ENCR40010157

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -25.4 kcal/mol is given below.

(((((((((...)))))(((..(((.....(((((((((((((......))))))))))))))))....)))....))))... (-25.40) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -27.33 kcal/mol.

The frequency of the MFE structure in the ensemble is 4.34 %.

The ensemble diversity is 10.96

(((((((((...))))).....{{.....,(((((((((((((......)))))))))))))|{{....})},...))))... [-27.33]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -24.80 kcal/mol is given below.

(((((((((...))))).............(((((((((((((......)))))))))))))..............))))... {-24.80 d=6.62} [ VIEW IN FORNA ]