Information In Noncoding For ENCR40010159

Accession Number:  ENCR40010159 Category:   promoter; regulatory region
Cross-Ref:   Regulatory_region_ID: RR_00155 Description:   TSS position: 69a ; CCNA leading gene: CCNA_00155 ; CCNA lagging gene: CCNA_00155 ; annotation of leading gene: DNA polymerase III
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:  
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:686.
Nucleotide sequence:   GUUUCGGCCUCUUCCCCGCGCGCGUCUUUUCGCUAAUGUCGGCGGUCCCUUCUCCACGGGUUCGCGCGGGGCUGAUUCUCCCCGGCGGCGGCUGAACCCGACAUCUGGACCGGACUA


Molecular structure In Noncoding For ENCR40010159

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -39.6 kcal/mol is given below.
..(((((((.((..((((((((.......(((((......))))).(((........)))..))))))))((((........)))))).))))))).(((..........))).... (-39.60) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -41.98 kcal/mol.
The frequency of the MFE structure in the ensemble is 2.12 %.
The ensemble diversity is 39.17
,.{((((((,{..,((((((((,,......|||{......})}||.(((........)))..)))}||}}(,,|.....,,,)}}}}}.})))))},|||......}}.,))),... [-41.98]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -23.50 kcal/mol is given below.
..............((((((((........((((......))))..(((........)))..))))))))............................................... {-23.50 d=26.65} [ VIEW IN FORNA ]