Information In Noncoding For ENCR40010161

Accession Number:  ENCR40010161 Category:   promoter; regulatory region
Cross-Ref:   Regulatory_region_ID: RR_99992 Description:   TSS position: -; CCNA leading gene: CCNA_99992 ; CCNA lagging gene: CCNA_99992 ; annotation of leading gene: tRNA-Arg
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:688.
Nucleotide sequence:   CGUUUGCGCCGGCCUCGCCUUUCGGCUAAGACCCGCUUCCCGCCUCCUGGGUUUCCAGGAAGGUCGCAG


Molecular structure In Noncoding For ENCR40010161

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -23 kcal/mol is given below.
....(((((((((...)))....(((.(((.....)))...)))((((((....)))))).)).)))). (-23.00) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -24.72 kcal/mol.
The frequency of the MFE structure in the ensemble is 6.1 %.
The ensemble diversity is 17.21
...,((((({((,{{.{{{....)))..}}.}}.}}.....||{((((((....)))))},)),}))). [-24.72]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -16.50 kcal/mol is given below.
....(((...((.(..(((....)))...).)).........((((((((....)))))).))..))). {-16.50 d=12.32} [ VIEW IN FORNA ]