Information In Noncoding For ENCR40010162

Accession Number:  ENCR40010162	Category:   promoter; regulatory region
Cross-Ref:   Regulatory_region_ID: RR_00197	Description:   TSS position: -; CCNA leading gene: CCNA_00197 ; CCNA lagging gene: CCNA_00197 ; annotation of leading gene: LSU ribosomal protein L19P
Organism:   Caulobacter crescentus	RefSeq:   NC_011916
Condition:   Rich medium	locus_tag:   -
Date:   2018/11/11	Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:689.

Nucleotide sequence:   ACCCGAAACCGGGUAAGCCCAAGGAGAC

Molecular structure In Noncoding For ENCR40010162

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -7.30 kcal / mol is given below.

(((((....))))).............. (-7.30) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -7.54 kcal/mol.

The frequency of the MFE structure in the ensemble is 67.41 %.

The ensemble diversity is 1.01

(((((....))))).............. [-7.54]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -7.30 kcal/mol is given below.

(((((....))))).............. { -7.30 d=0.61} [ VIEW IN FORNA ]