Information In Noncoding For ENCR40010164

Accession Number:  ENCR40010164	Category:   promoter; regulatory region
Cross-Ref:   Regulatory_region_ID: RR_00222	Description:   TSS position: -; CCNA leading gene: CCNA_00222 ; CCNA lagging gene: CCNA_00222 ; annotation of leading gene: glucose-6-phosphate isomerase/glucose-6 phosphate 1-epimerase
Organism:   Caulobacter crescentus	RefSeq:   NC_011916
Condition:   Rich medium	locus_tag:   -
Date:   2018/11/11	Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:691.

Nucleotide sequence:   GUCCGUAAACAGCGAUUUACCAAACCUGUGAGGACGACA

Molecular structure In Noncoding For ENCR40010164

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -8.00 kcal / mol is given below.

((((....((((.............))))..)))).... (-8.00) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -8.30 kcal/mol.

The frequency of the MFE structure in the ensemble is 61.26 %.

The ensemble diversity is 1.77

((((....((((.............))))..)))).... [-8.30]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -8.00 kcal/mol is given below.

((((....((((.............))))..)))).... { -8.00 d=1.01} [ VIEW IN FORNA ]