Information In Noncoding For ENCR40010166

Accession Number:  ENCR40010166 Category:   promoter; regulatory region
Cross-Ref:   Regulatory_region_ID: RR_00261 Description:   TSS position: 40a
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:  
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:693.
Nucleotide sequence:   UAAAGCACCUUACCGCGUCCGCUCGAUUCUGCCCGAGGCCCUGUCA


Molecular structure In Noncoding For ENCR40010166

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -6.00 kcal / mol is given below.
..............((.((.((........))..)).))....... (-6.00) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -6.85 kcal/mol.
The frequency of the MFE structure in the ensemble is 25.17 %.
The ensemble diversity is 11.23
....,,........{{.,,.{{..{.....||..)}}))...,,.. [-6.85]


The centroid secondary structure in dot-bracket notation with a minimum free energy of 0.00 kcal/mol is given below.
.............................................. { 0.00 d=7.30} [ VIEW IN FORNA ]