Information In Noncoding For ENCR40010174

Accession Number:  ENCR40010174 Category:   promoter; regulatory region
Cross-Ref:   Regulatory_region_ID: RR_00306 Description:   TSS position: -; CCNA leading gene: CCNA_00306 ; CCNA lagging gene: CCNA_00306 ; annotation of leading gene: hypothetical protein
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:701.
Nucleotide sequence:   GAUCUGGACCACCCGGCGCCCGACCAGGACGGGGAGAUCACGGC


Molecular structure In Noncoding For ENCR40010174

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -11.4 kcal/mol is given below.
(((((...((..((((.......)).))..))..)))))..... (-11.40) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -11.92 kcal/mol.
The frequency of the MFE structure in the ensemble is 43.03 %.
The ensemble diversity is 8.53
(((((...((.,((({...,...}}.))..)),.)))))..... [-11.92]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -7.20 kcal/mol is given below.
(((((...((..(.((.......))..)..))..)))))..... { -7.20 d=5.74} [ VIEW IN FORNA ]