Information In Noncoding For ENCR40010176

Accession Number:  ENCR40010176 Category:   promoter; regulatory region
Cross-Ref:   Regulatory_region_ID: RR_00308 Description:   TSS position: -; CCNA leading gene: CCNA_00308 ; CCNA lagging gene: CCNA_00308 ; annotation of leading gene: hypothetical protein
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:703.
Nucleotide sequence:   CCCUAGUUAGGACCGGAAUUUCCGAAGGAUCGCGCCGCCU


Molecular structure In Noncoding For ENCR40010176

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -6.00 kcal / mol is given below.
.(((....)))..(((....(((...))).....)))... (-6.00) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -7.16 kcal/mol.
The frequency of the MFE structure in the ensemble is 15.27 %.
The ensemble diversity is 9.67
.(({....}))..(((,...|||}..||,.....)),,,. [-7.16]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -4.60 kcal/mol is given below.
.(((....)))..(((.....)))................ { -4.60 d=7.60} [ VIEW IN FORNA ]