Information In Noncoding For ENCR40010177

Accession Number:  ENCR40010177 Category:   promoter; regulatory region
Cross-Ref:   Regulatory_region_ID: RR_00309 Description:   TSS position: -; CCNA leading gene: CCNA_00309 ; CCNA lagging gene: CCNA_00309 ; annotation of leading gene: cytosolic protein
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:704.
Nucleotide sequence:   CCAUUGAUCCUUAACCGUGUCGGGCAUAUCGAGCUGCCAUAACUAUAAUUCCUCGCAGGAAC


Molecular structure In Noncoding For ENCR40010177

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -8.50 kcal / mol is given below.
................((....((((........))))...)).....(((((...))))). (-8.50) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -9.43 kcal/mol.
The frequency of the MFE structure in the ensemble is 22.27 %.
The ensemble diversity is 6.44
................{{....((((........))))...}}.....{((((...))))}. [-9.43]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -7.90 kcal/mol is given below.
......................((((........))))..........(((((...))))). { -7.90 d=4.06} [ VIEW IN FORNA ]