| Accession Number: ENCR40010178 |
Category: promoter; regulatory region |
| Cross-Ref: Regulatory_region_ID: RR_00317 |
Description: TSS position: -66a ; CCNA leading gene: CCNA_00317 ; CCNA lagging gene: CCNA_00317 ; annotation of leading gene: GTP-binding protein CgtA |
| Organism: Caulobacter crescentus |
RefSeq: NC_011916 |
| Condition: Rich medium |
locus_tag: - |
| Date: 2018/11/11 |
Reference: Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:705. |
| Nucleotide sequence: CCUUGGGACAAAAGGACCCC |
Results for minimum free energy prediction |
| The optimal secondary structure in dot-bracket notation with a minimum free energy of -2.90 kcal / mol is given below. |
|
((((.......)))).....
(-2.90)
[ VIEW IN FORNA ]
|
Results for thermodynamic ensemble prediction |
| The free energy of the thermodynamic ensemble is -3.14 kcal/mol. |
| The frequency of the MFE structure in the ensemble is 67.24 %. |
| The ensemble diversity is 3.21 |
|
((((.......)))).....
[-3.14] |
| The centroid secondary structure in dot-bracket notation with a minimum free energy of -2.90 kcal/mol is given below. |
|
((((.......)))).....
{ -2.90 d=2.10}
[ VIEW IN FORNA ]
|