Information In Noncoding For ENCR40010180

Accession Number:  ENCR40010180 Category:   promoter; regulatory region
Cross-Ref:   Regulatory_region_ID: RR_00321 Description:   TSS position: 72a ; CCNA leading gene: CCNA_00321 ; CCNA lagging gene: CCNA_00321 ; annotation of leading gene: LSU ribosomal protein L21P
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:707.
Nucleotide sequence:   GCCCUCUUGUGUGCUUUCGUCGCGCGCCUCGGCUGAAUCCGCCGCUACGCCGUUGACUCCCGAGCCUUGGGCUGUAUAAGUCGCGCCCUCUUCGCCCGCCGGGUUUCCGAGCGGGCGUUCCCUAUUUUGCGAACGCACGUUUUUAAGGCGCUAACCU


Molecular structure In Noncoding For ENCR40010180

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -54.1 kcal/mol is given below.
(((((....(((((.(((((...(((...((((.......))))...)))(((.((((....((((...)))).....))))))).......((((((((((....))).)))))))...........))))).)))))......))).))...... (-54.10) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -56.73 kcal/mol.
The frequency of the MFE structure in the ensemble is 1.39 %.
The ensemble diversity is 24.18
((({,...,(((((.(((((,{,(((...((((.......))))...)))||,,((((....((((...)))).....)))))}}.......((((((((((....))).)))))))...........))))).)))))......})),}}...... [-56.73]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -50.80 kcal/mol is given below.
((((.....(((((.(((((...(((...((((.......))))...)))....((((....((((...)))).....))))..........((((((((((....))).)))))))...........))))).))))).......)).))...... {-50.80 d=15.62} [ VIEW IN FORNA ]