Information In Noncoding For ENCR40010181

Accession Number:  ENCR40010181 Category:   promoter; regulatory region
Cross-Ref:   Regulatory_region_ID: RR_00340 Description:   TSS position: 38a ; CCNA leading gene: CCNA_00340 ; CCNA lagging gene: CCNA_00341 ; annotation of leading gene: succinyl-CoA synthetase subunit beta
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:708.
Nucleotide sequence:   CCUUCACCUUAUCGCCCACACGCGGUUGCGCCUGCGAAACAGCGCUCCUAUAACCCGGCCACAUUUCAGAAAGCCGUCGUCGAGACCGGGCCCUCA


Molecular structure In Noncoding For ENCR40010181

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -19.9 kcal/mol is given below.
.............((((......((..((((.((.....)))))).))........(((.............)))(((.....))).))))..... (-19.90) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -21.6 kcal/mol.
The frequency of the MFE structure in the ensemble is 6.37 %.
The ensemble diversity is 21.22
.............(({{....|,{{|.(((,,((.....))))))..,.....,,,(((.............}}}{{{...,.))}.))))..... [-21.60]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -9.90 kcal/mol is given below.
.............((((..........(((..((.....)).)))...........(((.............))).((.....))..))))..... { -9.90 d=14.50} [ VIEW IN FORNA ]