Information In Noncoding For ENCR40010182

Accession Number:  ENCR40010182 Category:   promoter; regulatory region
Cross-Ref:   Regulatory_region_ID: RR_00342 Description:   TSS position: -; CCNA leading gene: CCNA_00342 ; CCNA lagging gene: CCNA_00343 ; annotation of leading gene: 2-oxoglutarate dehydrogenase E1 component
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:709.
Nucleotide sequence:   UGCGGUAGCGCUCCCGUAAGCAGCGGAUCUGAAGGCGACAAAUCCA


Molecular structure In Noncoding For ENCR40010182

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -8.60 kcal / mol is given below.
(((((........)))))......((((.((.......)).)))). (-8.60) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -9.48 kcal/mol.
The frequency of the MFE structure in the ensemble is 23.97 %.
The ensemble diversity is 13.10
,(((,...||}..||||.....},||{,.{{.......},.,}}}. [-9.48]


The centroid secondary structure in dot-bracket notation with a minimum free energy of 0.00 kcal/mol is given below.
.............................................. { 0.00 d=9.61} [ VIEW IN FORNA ]