Information In Noncoding For ENCR40010184

Accession Number:  ENCR40010184	Category:   promoter; regulatory region
Cross-Ref:   Regulatory_region_ID: RR_00354	Description:   TSS position: -; CCNA leading gene: CCNA_00354 ; CCNA lagging gene: CCNA_00354 ; annotation of leading gene: hypothetical protein
Organism:   Caulobacter crescentus	RefSeq:   NC_011916
Condition:   Rich medium	locus_tag:   -
Date:   2018/11/11	Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:711.

Nucleotide sequence:   GCCGGAGCGUGAUAAACACUCUUUUCACCAAUCGUCGGUAGGGUUAUCCCUUCACCCAGUGACGCGGGGGAGUGCCCACAGCA

Molecular structure In Noncoding For ENCR40010184

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -23.9 kcal/mol is given below.

(((((...((((............))))......))))).((((..(((((((((...))))....)))))..))))...... (-23.90) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -25.52 kcal/mol.

The frequency of the MFE structure in the ensemble is 7.24 %.

The ensemble diversity is 13.92

((((({,.((({.,,......},.}))}...,,.,)))).((((..(((((((((...))))....)))))..))))...... [-25.52]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -22.10 kcal/mol is given below.

((((....((((............)))).......)))).((((..(((((((((...))))....)))))..))))...... {-22.10 d=8.78} [ VIEW IN FORNA ]