Information In Noncoding For ENCR40010186

Accession Number:  ENCR40010186 Category:   promoter; regulatory region
Cross-Ref:   Regulatory_region_ID: RR_00365 Description:   TSS position: -; CCNA leading gene: CCNA_00365 ; CCNA lagging gene: CCNA_00365 ; annotation of leading gene: ornithine decarboxylase
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:713.
Nucleotide sequence:   GCUCCGGCGGACCCGAAGUCCUCUAAACGCUGCUAACGCCGGCCUGGGUUUAACUUCCAACAGGGGGUUACGUGAA


Molecular structure In Noncoding For ENCR40010186

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -19.8 kcal/mol is given below.
((((.(((((((.....))))......((..((....))))))).)))).((((((((....))))))))...... (-19.80) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -21.48 kcal/mol.
The frequency of the MFE structure in the ensemble is 6.6 %.
The ensemble diversity is 19.52
{(,{,((|((((.....))))......,{{,{{....)}}))),,))},.((((((((....))))))))...... [-21.48]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -12.50 kcal/mol is given below.
........((((.....)))).............................((((((((....))))))))...... {-12.50 d=12.34} [ VIEW IN FORNA ]