Information In Noncoding For ENCR40010192

Accession Number:  ENCR40010192 Category:   promoter; regulatory region
Cross-Ref:   Regulatory_region_ID: RR_00421 Description:   TSS position: -; CCNA leading gene: CCNA_00421 ; CCNA lagging gene: CCNA_00420 ; annotation of leading gene: dihydroneopterin aldolase
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:719.
Nucleotide sequence:   CCCUAGAGCCUGCUUGGAACAACAGGCUCGACCAAGUUGAAAGAAAGGCCGCGCCUUGGCCGCUUCGCCCCUCGCCGACCCCGCGCCCGCCGCCGACACCGCCCGGAUCAUC


Molecular structure In Noncoding For ENCR40010192

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -30 kcal/mol is given below.
.....(((((((.(((...)))))))))).................(((.((((.(((((.............)))))....))))..))).(((........)))...... (-30.00) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -31.64 kcal/mol.
The frequency of the MFE structure in the ensemble is 6.93 %.
The ensemble diversity is 25.85
.....(((((((.(((...))))))))))..,...,,.........(((.(((,.{{(((,{....|,.....)))))...,)))),.))},||{.....,..})).,,... [-31.64]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -18.50 kcal/mol is given below.
.....(((((((.(((...)))))))))).................(((......(((((.............)))))..........)))..................... {-18.50 d=17.03} [ VIEW IN FORNA ]