Information In Noncoding For ENCR40010194

Accession Number:  ENCR40010194 Category:   promoter; regulatory region
Cross-Ref:   Regulatory_region_ID: RR_00466 Description:   TSS position: -; CCNA leading gene: CCNA_00466 ; CCNA lagging gene: CCNA_00466 ; annotation of leading gene: glycosyltransferase
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:721.
Nucleotide sequence:   GAUAGGCGAGUGUAGGUCGUUUUUGUCAUUCAGGAAGGGAAGCGUUCUUAAAUUUCCUGAAUAUUAAGUAUUAUAGCUACGAUUGGAGCGACGA


Molecular structure In Noncoding For ENCR40010194

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -22.1 kcal/mol is given below.
...............((((((((.(((((((((((((..(((....)))...))))))))))....(((......)))..))).)))))))).. (-22.10) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -23.44 kcal/mol.
The frequency of the MFE structure in the ensemble is 11.34 %.
The ensemble diversity is 10.23
...............((((((((.((((((((((((({{((,...}))}...))))))))))....(((......)))..))).)))))))).. [-23.44]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -20.70 kcal/mol is given below.
...............((((((((.(((((((((((((...............))))))))))....(((......)))..))).)))))))).. {-20.70 d=6.87} [ VIEW IN FORNA ]