Information In Noncoding For ENCR40010196

Accession Number:  ENCR40010196 Category:   promoter; regulatory region
Cross-Ref:   Regulatory_region_ID: RR_00469 Description:   TSS position: -; CCNA leading gene: CCNA_00469 ; CCNA lagging gene: CCNA_00469 ; annotation of leading gene: glycosyltransferase
Organism:   Caulobacter crescentus RefSeq:   NC_011916
Condition:   Rich medium locus_tag:   -
Date:   2018/11/11 Reference:   Christen B, et al (2011). The essential genome of a bacterium. Mol Syst Biol, 7:723.
Nucleotide sequence:   GAUAUACGGCCAUUAAGCUUCAUAGGGAUUACCGUAUUCCA


Molecular structure In Noncoding For ENCR40010196

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -5.50 kcal / mol is given below.
((.((((((..(((...((....)).)))..)))))))).. (-5.50) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -7.06 kcal/mol.
The frequency of the MFE structure in the ensemble is 7.98 %.
The ensemble diversity is 10.96
{,.((((((,..,{...{{....,}}}|}..))))))}).. [-7.06]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -4.10 kcal/mol is given below.
...((((((......................)))))).... { -4.10 d=7.12} [ VIEW IN FORNA ]