Information In Noncoding For ENCR40100033

Accession Number:  ENCR40100033 Category:   -
Cross-Ref:   - Description:   tRNA-Met
Organism:   Brevundimonas subvibrioides ATCC 15264 RefSeq:   NC_014375
Condition:   Rich medium locus_tag:   locus_tag:Bresu_R0047
Date:   2018/11/11 Reference:   Curtis, P.D. and Brun, Y.V. (2014) Identification of essential alphaproteobacterial genes reveals operational variability in conserved developmental and cell cycle systems, Mol. Microbiol., 93, 713-775.
Nucleotide sequence:   GGGCGCGUAGCUCAAUGGUUAGAGCCGACCGCUCAUAACGGUCUGGUUGGGGGUUCGAGUCCCUCCGCGCCUACCG


Molecular structure In Noncoding For ENCR40100033

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -31.4 kcal/mol is given below.
((((((((((((....))))).(((((((((.......))))).))))(((((.......)))))))))))).... (-31.40) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -32.41 kcal/mol.
The frequency of the MFE structure in the ensemble is 19.41 %.
The ensemble diversity is 20.07
((((((({{(((....,}}}},{(({(((((.......))))).)))}(((((.......)))))))))))).... [-32.41]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -30.50 kcal/mol is given below.
(((((((((((......)))).(((((((((.......))))).))))(((((.......)))))))))))).... {-30.50 d=13.52} [ VIEW IN FORNA ]