Information In Noncoding For ENCR40100035

Accession Number:  ENCR40100035	Category:   -
Cross-Ref:   -	Description:   tRNA-Ser
Organism:   Brevundimonas subvibrioides ATCC 15264	RefSeq:   NC_014375
Condition:   Rich medium	locus_tag:   locus_tag:Bresu_R0049
Date:   2018/11/11	Reference:   Curtis, P.D. and Brun, Y.V. (2014) Identification of essential alphaproteobacterial genes reveals operational variability in conserved developmental and cell cycle systems, Mol. Microbiol., 93, 713-776.

Nucleotide sequence:   GGACAGGTGGCGGAGTGGTCGATCGCGCACGCTTGGAAAGCGTGTGTAGGTGAAAGCCTACCGAGGGTTCGAATCCCTCTCTGTCCGCCA

Molecular structure In Noncoding For ENCR40100035

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -40.30 kcal/mol is given below.

(((((((((((((.....))).))))((((((((...))))))))((((((....)))))).(((((.......))))).)))))).... (-40.30) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -41.89 kcal/mol.

The frequency of the MFE structure in the ensemble is 7.56%.

The ensemble diversity is 20.12

{{{{{(((((((({,,,,}},.})))((((((((...))))))))((((((....)))))).(((((.......))))),)))})),,,. [-41.89]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -35.20 kcal/mol is given below.

((((((....................((((((((...))))))))((((((....)))))).(((((.......))))).)))))).... {-35.20 d=13.49} [ VIEW IN FORNA ]