Information In Noncoding For ENCR40120025

Accession Number:  ENCR40120025 Category:   rrf
Cross-Ref:   RFAM:RF00001 Description:   5S ribosomal RNA
Organism:   Escherichia coli O157:H7 str. EDL933 RefSeq:   NZ_CP008957
Condition:   LB agar locus_tag:   locus_tag:EDL933_RS25060
Date:   2020/6/18 Reference:   Warr, A. R., Hubbard, T. P., Munera, D., Blondel, C. J., Zur Wiesch, P. A., Abel, S., ... & Waldor, M. K. (2019). Transposon-insertion sequencing screens unveil requirements for EHEC growth and intestinal colonization. PLoS pathogens, 15(8), e1007676.
Nucleotide sequence:   CCTGGCGGCCTTAGCGCGGTGGTCCCACCTGACCCCATGCCGAACTCAGAAGTGAAACGCCGTAGCGCCGATGGTAGTGTGGGGTCTCCCCATGCGAGAGTAGGGAACTGCCAGGC


Molecular structure In Noncoding For ENCR40120025

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -45.50 kcal/mol is given below.
((((((((.........((((....)))).((((((((((...((.((...(((..((...))..)))...)))).))))))))))..(((.(((....))))))..)))))))). (-45.50) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -47.06 kcal/mol.
The frequency of the MFE structure in the ensemble is 7.95 %.
The ensemble diversity is 29.39
((((((((,.....,,.((((....)))).((((((((((...{{{((...{||..,{,{.||..)}}...)))).)))))))))),{((|.{((....)))))),.)))))))). [-47.06]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -33.41 kcal/mol is given below.
((((((((.........((((....)))).((((((((((....................................))))))))))......(((....))).....)))))))). {-33.41 d=20.29} [ VIEW IN FORNA ]