Information In Noncoding For ENCR40120035

Accession Number:  ENCR40120035 Category:   -
Cross-Ref:   - Description:   tRNA-Gly
Organism:   Escherichia coli O157:H7 str. EDL933 RefSeq:   NZ_CP008957
Condition:   LB agar locus_tag:   locus_tag:EDL933_RS27300
Date:   2020/6/18 Reference:   Warr, A. R., Hubbard, T. P., Munera, D., Blondel, C. J., Zur Wiesch, P. A., Abel, S., ... & Waldor, M. K. (2019). Transposon-insertion sequencing screens unveil requirements for EHEC growth and intestinal colonization. PLoS pathogens, 15(8), e1007686.
Nucleotide sequence:   GCGGGAATAGCTCAGTTGGTAGAGCACGACCTTGCCAAGGTCGGGGTCGCGAGTTCGAGTCTCGTTTCCCGCTCCA


Molecular structure In Noncoding For ENCR40120035

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -31.00 kcal/mol is given below.
(((((((..((((........)))).(((((((...))))))).....(((((.......)))))))))))).... (-31.00) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -32.83 kcal/mol.
The frequency of the MFE structure in the ensemble is 5.17 %.
The ensemble diversity is 5.82
(((((((..((((........)))).(((((((((....).)))))))|((((.......)))),))))))).... [-32.83]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -32.20 kcal/mol is given below.
(((((((..((((........)))).(((((((((....).))))))))((((.......)))).))))))).... {-32.20 d=3.59} [ VIEW IN FORNA ]