Information In Noncoding For ENCR40130001

Accession Number:  ENCR40130001 Category:   -
Cross-Ref:   - Description:   tRNA-Cys
Organism:   Providencia stuartii strain BE2467 RefSeq:   NZ_CP017054
Condition:   LB medium locus_tag:   locus_tag:BGK56_RS00915
Date:   2020/6/28 Reference:   Johnson, A. O., et al. (2020). Transposon Insertion Site Sequencing of Providencia stuartii: Essential Genes, Fitness Factors for Catheter-Associated Urinary Tract Infection, and the Impact of Polymicrobial Infection on Fitness Requirements. Msphere, 5(3).
Nucleotide sequence:   GGCGCGTTAGCAAAGCGGTTATGCACCGGATTGCAAATCCGTGTAGCTCGGTTCGACTCCGGGACGCGCCTCCA


Molecular structure In Noncoding For ENCR40130001

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -28.70 kcal/mol is given below.
(((((((((((...((((...((((......))))...))))...)))(((.......))).)))))))).... (-28.70) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -29.93 kcal/mol.
The frequency of the MFE structure in the ensemble is 13.66 %.
The ensemble diversity is 18.54
(((((((({((...,{{|,,.((((,,{{{{|,,,,}}))))}},,|{(((.......)))})))))))).... [-29.93]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -18.20 kcal/mol is given below.
((((((((...................(((.......))).......((((.......)))))))))))).... {-18.20 d=13.60} [ VIEW IN FORNA ]