Information In Noncoding For ENCR40130015

Accession Number:  ENCR40130015 Category:   -
Cross-Ref:   - Description:   tRNA-Arg
Organism:   Providencia stuartii strain BE2467 RefSeq:   NZ_CP017054
Condition:   LB medium locus_tag:   locus_tag:BGK56_RS14945
Date:   2020/6/28 Reference:   Johnson, A. O., et al. (2020). Transposon Insertion Site Sequencing of Providencia stuartii: Essential Genes, Fitness Factors for Catheter-Associated Urinary Tract Infection, and the Impact of Polymicrobial Infection on Fitness Requirements. Msphere, 5(17).
Nucleotide sequence:   GCGCCCGTAGCTCAGCTGGATAGAGCGCTGCCCTCCGGAGGCAGAGGTCTCAGGTTCGAATCCTGTCGGGCGCGCCA


Molecular structure In Noncoding For ENCR40130015

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -32.00 kcal/mol is given below.
(((((((.......((.((((.((((.(((.((((........))))...)))))))..)))).))))))))).... (-32.00) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -32.52 kcal/mol.
The frequency of the MFE structure in the ensemble is 43.06 %.
The ensemble diversity is 17.79
(((((((..,....((.((((.((((.(((,((((.....,..)}))...)))))))..}})),)}))))))).... [-32.52]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -32.00 kcal/mol is given below.
(((((((.......((.((((.((((.(((.((((........))))...)))))))..)))).))))))))).... {-32.00 d=11.97} [ VIEW IN FORNA ]